Tuesday, August 25, 2020
Total Compensation in HRM
Forming Responsibly - Essay Example The article Designing Responsibly finds the Fashioning Responsibly. The activities of sweatshops normally present grave dangers to the individuals working in them, just as, neglect to remunerate them satisfactorily. Under most conditions, sweatshops misuse all work laws in presence. The design business needs to bear all the obligations that outcome from their creation exercises. The design business is the most careful branch of the economy in utilizing poor monetary conditions, just as, provocation of the laborers who power the creation frameworks of these organizations. The majority of these design houses have fabricating plants whereby it utilizes various specialists to create a given item inside the opportune time. The short cutoff times between propelling of an item and the development and extension of market circles makes some style houses not to cling to the approaches and laws set to administer the conveyance of work in the general public. These style enterprises work sweatsho ps so as to fulfill their market needs, just as, give considerable rivalry to the exercises and practices embraced inside their creation lines. What's more, these rigid working conditions additionally result from the tight cutoff times that they need to meet both in the business just as in the market. The conditions in sweatshops worked by style houses generally identify with various attributes, key among them being exhausting its laborers for significant stretches of the day and once in a while in the night. Furthermore, these perspiration shops likewise pay these laborers underneath the necessary the lowest pay permitted by law, just as, path beneath the set market guidelines in the design business. This is in finished dismissal and all out criticism of the laws and guidelines commanding installment of additional minutes to representatives who work for extended periods, or those legitimate laws relating least wages. The administrators of sweatshops as a rule basically misuse their representatives. They consider their to be as a way to accomplish their objectives and goals. They don't consider their social prosperity and other money related status and necessities the representatives in this style sweatshops wind up taking a shot at texture for extended periods, without the correct working conditions that may likewise risk their wellbeing conditions, and still get the most reduced installments toward the finish of the day.3 This maltreatment of work in sweatshops particularly in the design business happens for the most part on account of the poor monetary measures wherein these enterprises are found. For example, most style enterprises in the United States and other created nations have their base camp at verdant and well-off areas in significant urban communities and towns in the United States. These base camp of a given line of style, or plan and brand of design, endeavor to advance their image, just as, concocting the best structures to satisfy advertise ne eds. In any case, they don't have their assembling plants in these verdant areas and town premises. Because of the concentrated necessity of work in the creation of these textures, as the greater part of the style business isn't well techno created, they find their ventures in nations
Saturday, August 22, 2020
Answer quesiton Essay Example | Topics and Well Written Essays - 750 words
Answer quesiton - Essay Example By giving countless common and neighborhood official workplaces, the mestizos stepped their characteristic of power and authority over the bicameral type of government in almost all parts of the sociological and political history of the Philippines. Further, they combined their privileges and force by giving authoritative rights and powers in the hands of their blood family members and companions. Their siblings, sisters and other close individuals were given senior situations in the force coalitions, and children and nephews were vested with junior position levels. The thought was to guarantee all out mastery of the nation in the hands of the mestizos. Along these lines they maintained a strategic distance from law based types of imparting capacity to the chosen delegates of the individuals. The starting point of political administration rule was articulated by the before Aquinos and Cojuangcos and has since, through the procedure of plunge, passed onto the hands of the current ruler, Corazon Aquino. The nonappearance of vote based procedure and the standard of administrations has been one perspective by which the Filipino political situation contrasts fundamentally from that of other South East Asian countries. One more perspective is that, not normal for other SE Asian countries, which gloat of monstrous bureaucratic style of administering, in Philippines the mestizos are under the regulatory control of the Americans, to whom they have promised support, as a byproduct of a deal to stay in power. There is a base number of positions for government workers and the whole force sharing lies in the hands of the mestizos. There were monstrous transformations into Christianity and today, almost 90% of the populace is of Christian confidence. These transformations were done, not through utilization of the vehicle of the Spanish language, however by utilization of a large group of different dialects. In spite of the fact that Philippines was administered by the Spaniards for a significant period of time, Spanish has not become the regular language of the neighborhood individuals of the island
Sunday, July 26, 2020
Jefferson City
Jefferson City Jefferson City, city (1990 pop. 35,481), state capital and seat of Cole co., central Mo., on the south bank of the Missouri River, near the mouth of the Osage; inc. 1825. The state government is the major employer, but the city, with rail and river facilities, is also the commercial and processing center of an agricultural area. Machinery, construction materials, dairy products, furniture, and transportation equipment are produced. It was a small river village when it was chosen (1821) for the state capital; the legislature moved there from St. Charles in 1826. Because of divided loyalties and the difficulties of holding the state in the Union, Jefferson City was occupied by Union troops during the Civil War. The Italian-Renaissance capitol of Carthage marble (completed 1917) contains murals by Thomas Hart Benton and N. C. Wyeth , and is the site of the Missouri state museum. In the city are Lincoln Univ., the state penitentiary, and a national cemetery. The Columbia Electronic Encyclopedia, 6th ed. Copyright © 2012, Columbia University Press. All rights reserved. See more Encyclopedia articles on: U.S. Political Geography
Friday, May 22, 2020
The Role of Civil Society in Global Citizenship - Free Essay Example
Sample details Pages: 5 Words: 1353 Downloads: 9 Date added: 2019/04/12 Category Society Essay Level High school Tags: Citizenship Essay Did you like this example? Global citizenship or globalization is not a modern phenomenon nowadays. Actually, the term globalization was first appeared in the 1930s and widely used by economists and other social scientists by the 1960s. According to Dierks, globalization process includes technological, political, economic, and cultural dimensions that interconnect individual, governments, and firm across national borders (6). Donââ¬â¢t waste time! Our writers will create an original "The Role of Civil Society in Global Citizenship" essay for you Create order Globalization is the worldwide movement toward economic, finance, trade, and communications integration. Moreover, this phenomenon also refers to the transformation in the society, environment, and politic globally, which gives the signs or notices to individuals as well as communities on a universal scale. Therefore, global citizenship is not limited in a local area or in a national territory. Global citizenship has brought many advantages for people all over the world. These effects are to create the international teams of rescuing and financial aid; to diversify the products in the range of prices, qualities, and designs; to be able to easily travel around the world. There are various external factors that influence global citizenship. Some factors are religions, economics, cultures, and environment. Since thousands of years ago, many missionaries of Buddha, Christian, Catholic, and Islam traveled to the other land far away from their hometown in order to transmit the values and the spirits of their religions. From the second century BC, the Silk Road was formed and developed abundantly from China to West Asia and even reached Europe. This very long road was considered as the biggest trade system in the ancient world, which connected two civilizations between the East and the West. The demand for exchange necessary products, valuable items such as silk, salt, or diamond and innovations like printing techniques, has overcome the countrys boundaries. The rivalry stimulates the cooperation among international companies, organization, and governments. This demonstrates cooperation to preserve globalization (Allen 11). Moreover, the cultural differenc es between countries have attracted a lot of explorers. Each country possesses their own culture of cuisine, communication, and fashion. The curiosity stimulates the people to travel abroad, to exchange, and to learn new things. Furthermore, global warming issues have tightened the distance between countries. Only one country cannot make a big change to save the environment. It has to be the efforts of everyone, every country, from the First World to the Third World. The author Paul Sherman in the University of Guelph-Humber stated three dimensions that involve being pro-global citizenship, which is awareness, responsibility, and participation. Global citizens aware themselves as a part of the world. They do not belong to one specific area, but they consider themselves as the citizens of the world. According to Madeleine F. Green, an author of NAFSA: Association of International Educators, global citizenship is initially the experience with different countries, peoples, and cultures. Then it creates a connection between the local and the global. Moreover, global citizens usually recognize their responsibilities following the important events and matters in their communities and in the world. International education is put on the priority. Traveling abroad to participate in the educational program has served a pivotal step in the lives of many self-described global citizens (Schattle 15). They take initiative to equip necessary knowledge, skills, and critical thinking to take action and protect their missions on the global scale. The Earth Hour campaign is a proper example of global citizenship. This is an annual worldwide event held by the World Wide Fund for Nature, which appeals every ones cares about our planet and our responsibility to protect it. Another picture of global citizenship is the LGBTQ community. LGBT people have existed in many communities for a long time ago. However, they are just the minorities that do not dare to stand up and gain the equality for themselves. Due to global citizenship, these people connect to each other and organize as a global community. This group becomes bigger and bigger, represents, and fights in order to gain justice for every individual. While many aspects support the development of the intercontinental connection, there have been several certainly disadvantages of global citizenship. In the trend of globalization, a lot of free trade agreements are established to promote economic development among countries in the world. However, this also become a cause of job losses in developed countries. Big companies have moved their factories to developing countries in order to derive cheap labor. Therefore, they can reduce their product price and be more competitive in the global market. Based on the article of John Rennie Short from the University of Maryland, the living standards of the working class in the First World sloped downward because of losing jobs. Moreover, the globalization also an entry for immigrants to move easily from this country to the other country. This has raised many troubles for the local residents in America and Europe such as criminals, pollution, and unsafe status in politics and society. Jagdish B hagwati in his book gave an argument that the anti-globalization sentiments on the right extend easily to anti-immigration attitudes because immigration adds to environmental problems (25). Consequently, several authorities of developed countries showed their actions to against globalization. For example, the intense regulations on the immigrant and border security issues of President Donald Trump since he was elected at the end of 2016. The Brexit vote in the United Kingdom and the rise of a nationalism in Europe are also an obvious reaction against global citizenship. Global citizenship is not a new phenomenon, but it is still a controversial issue that the government and the experts keep discussing nowadays. In my perspective, I see the global citizenship has brought more advantages than its drawbacks. Hence, I am pro global citizenship. In ancient times, battles and wars occurred everywhere. That was also a reason why people traveled around the world. Moreover, because of traveling, Christopher Columbus accidentally discovered the land of the Americas. It means global citizenship is obviously inevitable, and no one can stop it. The only thing that we can do is to develop and shape it in the appropriate way in order to minimize its disadvantages. Due to globalization, people have chances to use quality products with an affordable price. Furthermore, this world is created with a lot of fantastic landscapes, sightseeing, and mysteries. People have the rights to discover it. Besides, global citizenship help people from different sides of the world g et closer to each other. Recently, in June 2018, Thailand youth soccer team were trapped in a flooded cave in the north of this country. A search and rescue mission was appropriately established. An extraordinary international operation included hundreds of cave and rescue experts and military force from several countries such as Australia, Britain, Japan, China, Myanmar, Laos, and America. Through this emergency case, we can see the effectivity of cooperation and global citizenship among countries, which showed the consolidation, not the division. In the future, if the global citizenship trend continues the way it is, the global transactions and trade would be stretched out. Then the world might need to use a single currency and a single central bank: with perfectly functioning markets, there would be no need for currency adjustment (King 10). It seems like the future world might be operated as the model of the European Union. On the other hand, with the development of technologies and artificial intelligence (AI), human life will be more connected with the robots. Every house in every country would be controlled by the AI steward system. Most of the jobs would be lost, so unemployment rate will dramatically increase. Transportation will be more in high technologies such as self-driving cars and flying cars. Space tourism would be opened, and people would travel to the Moon and the other planets more often. Oil and fossils resources would be exhausted, and wars would happen because of the oil rival among countries. The world p opulation would reach 10 billion. Skyscrapers will be built more in the rural areas. If global warming cannot control, people could move to live in the North and South poles. Super hurricanes, tornadoes, earthquakes, and tsunamis would frequently occur. Moreover, many cities and even countries such as Maldives and Netherlands would totally disappear in the world map because the sea level increases.
Friday, May 8, 2020
Abuse of Power in Doubt, by John Patrick Shanley - 1177 Words
Power is earned, not given. There are many different types of power that people can earn. Power becomes a problem when it is not questioned or tested. Therefore, the one with the power would have total control over anything or anyone they wanted, or they would feel that way. People with power feel invincible when it is not questioned. Throughout history it has been proven that this creates a problem. For example, Richard Nixon and the Watergate scandal is similar to the scandal with Father Flynn in Doubt. Doubt, by John Patrick Shanley, exemplifies an underlying message that unquestioned faith leads to abuse of power. Specifically, shown in Father Flynnââ¬â¢s reputation, cover up, and resignation, which all correlate to Richard Nixonââ¬â¢sâ⬠¦show more contentâ⬠¦In the election of 1972, Nixon won by over sixty percent of the votes and won all states except Massachusetts against George McGovern (ââ¬Å"The History Placeâ⬠¦Ã¢â¬ ). This is one of the biggest landslide s in U.S. Presidential election history. In January 1973, Richard Nixonââ¬â¢s approval rating was sixty-seven percent, which is relatively high compared to current president Barack Obamaââ¬â¢s forty-seven percent and many other Presidents before him (ââ¬Å"The History Placeâ⬠¦Ã¢â¬ ). Therefore, he had a great reputation and was in the highest possible position, the leader of the free world, just like Father Flynn was in his parish. Richard Nixon also had a very positive relationship with members of the White House. For example, members of the White House were caught breaking in and violating the law to get President Nixon re-elected (ââ¬Å"The History Placeâ⬠¦Ã¢â¬ ). Abuse of power comes from a high reputation that is unquestioned. When oneââ¬â¢s unquestioned reputation is being attacked one often feels obligated to make a plan to cover up accused actions to save their reputation. When Sister Aloysius first accuses Father Flynn of having an inappropriate relationship with Donald Muller he responds, ââ¬Å"Happened? Nothing happened. I had a talk with the boy.â⬠(32). Finally, Father Flynn says he did have some interaction with Donald after denying it for a while, but he still clearly states nothing happened. Father Flynn ends the conversation by saying, ââ¬Å"I donââ¬â¢t wish to continue this conversation at all further. And if
Wednesday, May 6, 2020
Carpe Diem Poetry Free Essays
ENG. 1102 Paper 1 Carpe Diem Poetry ââ¬Å"To The Virgins, To Make Much of Timeâ⬠by Robert Herrick and ââ¬Å"To His Coy Mistressâ⬠by Andrew Marvell are two great examples of Carpe Diem poetry. Their vivid imagery, symbolism, and usage of simile and metaphor are what make these poems memorable. We will write a custom essay sample on Carpe Diem Poetry or any similar topic only for you Order Now Their usage of these terms also makes the poems more inviting and makes the usage of the Carpe Diem tradition more apparent. Likely risque for their times, I find both poems somewhat romantic and tame for our time period. The primary metaphor of ââ¬Å"To The Virgins, To Make Much Of Timeâ⬠is ââ¬Å"Gather ye rosebuds while ye may, old time is still a-flying; and this same flower that smiles today, tomorrow will be dyingâ⬠(961). This opening metaphor makes it clear that the theme of this poem is Carpe Diem. From my understanding and also from my introductory Latin class Carpe Diem is popularly known as ââ¬Å"Seize the Dayâ⬠though this is not the literal translation. Roses are fresh and supple like youth; they are fragile, beautiful, and pure. These are characteristics also associated with virgins. I have found in many literary works that virginity is compared to a rose. Herrick is urging the young to enjoy their youth before it evades them. ââ¬Å"The glorious lamp of heaven, the sun, the higher heââ¬â¢s a getting, the sooner will his race be run, and nearer heââ¬â¢s to settingâ⬠is another metaphor using the personification of the sun to show the passage of time (916). The sun is an example of life; the more time that passes, or the rather the farther the race is run, is the closer life is to come to an end or the closer to the sun setting. The sun and itââ¬â¢s rising and setting is something that is very commonly used on obituaries to mark the birth and death of a person. That age is best which is the first, when youth and blood are warmer; but being spent, the worse, and worst times still succeed the formerâ⬠(916). The previous passage is the speaker saying that everything is better when you are young. You are livelier and more warm blooded when youââ¬â¢re young; and everything after that gets worse and worse. This is true from a physiological standpoint; as you age the way your hormones work change and the process that build up substances needed in your body slow and at times stop, an example of this medically is osteoporosis. The last stanza of the poem reads, ââ¬Å"Then be not coy, but use your time; and while ye may, go marry: For having lost but once your prime, you may for ever tarryâ⬠(916). I believe the speaker is saying to the reader donââ¬â¢t be shy, donââ¬â¢t waste your youth, marry now while your young and beauty; and while you are filled with life and vigor. Once your beauty is gone it may be harder or it may be something that you may never do. Due to this poem being in the love and hate section of our book and also with it being about virgins, I canââ¬â¢t help, but think that this also has some subtle sexual connotations as well. I think this because the speaker is urging virgins and not just people in general to make the most of life. The speaker also uses the symbolism of the rose as a comparison for youth, but a woman transitioning for a virgin is also compared to a flower blooming. Between ââ¬Å"To The Virgins, To Make Much Of Timeâ⬠and ââ¬Å"To His Coy Mistressâ⬠I find that ââ¬Å"To His Coy Mistressâ⬠uses the most imagery; and because of that it is my favorite of the two poems. ââ¬Å"Had we but world enough, and time, this coyness, lady, were no crime. We would sit down, and think which way to walk, and pass our long loveââ¬â¢s day. Though by the Indian Gangesââ¬â¢ side shouldst rubies find; I by the side of Humber would complainâ⬠(951). I found this opening stanza important, because it set the stage for the Carpe Diem theme. The speaker has compare the ladies coyness to a crime because they donââ¬â¢t have enough time. This automatically says to me as he reader that he wants her to give up her shyness and give into him because they may never get the chance. He spends telling him mistress all the time he would spend praising her body, but saves her heart last. Though he suggest that he would take his time loving his mistress he then states, ââ¬Å"For, lady, you deserve this state, nor would I love at a lower rate. But at my back I always hear timeââ¬â¢s winged chariot hurrying nearâ⬠(951). This is the speaker again stating that there is not enough time for them to wait any longer because time is quickly approaching. The speaker also states that his lust for her will turn to ash soon if they continue to wait and that her long preserved virginity and honor will also turn to dust. He is urging his mistress to be with him by constantly referencing death, ââ¬Å"The graves a fine and private lace, but none, I think, do there embraceâ⬠(951). I have found that of the two poems that ââ¬Å"To His Coy Mistress does not put as much emphasis of seizing the day in general, but more so of seizing the moment now sexually. Though there were some references from the speaker about is mistress heart most of the references were in regards to his sexual desires. He references love several times, but warps it with his immediate cause for action. It seems that this speaker is using his love for her or saying that he has love for his mistress as a way to bring about her deflowering. This must be something that is a recurring trend across time periods as this can also be found much more apparent and much more frequently in our time period. Works Cited Herrick, Robert. ââ¬Å"To The Virgins, To Make Much Of Time. â⬠Abcarian, Richard, Marvin Klotz, and Samuel Cohen. Literature: The Human Experience. 10th. Boston: Bedford/st Martins, 2010. 916 Marvell, Andrew. ââ¬Å"To His Coy Mistress. â⬠Abcarian, Richard, Marvin Klotz, and Samuel Cohen. Literature: The Human Experience. 10th. Boston: Bedford/st Martins, 2010. 950-951 How to cite Carpe Diem Poetry, Papers
Tuesday, April 28, 2020
Same-Sex Adoption free essay sample
A paper showing the pros and cons of gay couples adopting children. It is estimated that between one and nine million American children have at least one parent who is gay. While most of these children were produced in a heterosexual relationship before the gay parent ?came out,? an increasing number of same-sex partners are becoming parents through adoption or foster parenting. This paper explores research and opinions in favor and against adoption of children by same-sex couples. However, it must be addressed that, to a large extent, this is an unknown area because the baby boom is still very young. There arent enough same-sex adoptions to be a representative sample. While my guess is that having parents who are of the same sex wont be the major focus in an adolescents life, it will still subject that individual to teasing and homophobic reactions from his/her peers. We will write a custom essay sample on Same-Sex Adoption or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page (Martin) In addition, while state laws are changing, many states are still being influenced by homophobia. Therefore, legally, same-sex couples can adopt, but many will be denied the opportunity anyway. Only recently has it become more normal for same-sex couples to adopt children and it is impossible to draw accurate conclusions on the long-term effects same-sex adoption will have on children.
Thursday, March 19, 2020
Samwise Gamgee Essays - Forest Ecology, Biology, Botany, Ecology
Samwise Gamgee Essays - Forest Ecology, Biology, Botany, Ecology Samwise Gamgee What exactly is a rain forest, you say? Well, on the outside, a rain forest has a wall averaging 20 feet thick that is made of a tangle of vines that love light. This wall seals off the interior creating the illusion that the whole jungle is this thick. But if you find an animal path or stream to follow, you can slip through and enter this mysterious world. Once you're inside, you can look up and see a tree canopy that's as high as a 17 story building! And it's pretty dark too, a perpetual twilight. Only 1% of the sunlight ever actually touches the floor of the forest. And moonlight, even a full moon, doesn't get through at all. You'd better have a flashlight with you if you plan on reading any comics. Rain forests have different layers that support different animals and insects. Some plants and animals occupy specific layers, while others live and feed wherever they can. I live in the lower canopy of the South American rain forest because a lot of the fruit I like to eat is found there. The tallest trees in the canopy layer grow up to 200 feet high. Some of the trees that poke through (called the "emergents") have been known to grow as high as 270 feet. It is not uncommon for the expansive umbrella crown of an emergent tree to cover an entire acre. Now there's a good spot for a treehouse. Many types of indigenous people live in rain forests. The environment is perfect for tribes of hunter-gatherers. Local materials are used to make their blow guns, spears, and arrows. The forest also provides building and roofing materials, wild cotton for clothing, pharmaceuticals, cosmetics, and more. In fact, just about every need can be met by the rain forest. For these people, the rain forest is like living in a gigantic mall. Amazonian deep-forest Yanomamo are a group of forest people that can literally run up heavy trunked emergent trees (over 200 feet) without breaking a sweat. It's because of their remarkably wide feet, which also have advantages running around the muddy rain forest floors. The Pygmies are a tribe of honey gatherers that rely almost exclusively on the help of a bird called the Greater Honeyguide to direct them to the beehives. This little bird leads the Pygmies with its rasping, churring chatter and its white outer tail feathers to point out the proper tree. The bird lives on beeswax, so after the Pygmies climb the tree with a bundle of smoking leaves to put the bees to sleep, they take the honey and leave the beeswax behind as a reward for the bird. Here you'll find bats with wingspans up to 5.5 feet, moths with wingspans of 12 inches, frogs so big they could eat rats, and rats themselves weighing up to 100 pounds. Let's take a closer look at just a few of the interesting animals and insects that live in the rain forrest. Piranha, The piranha is a small fish that is activated into a feeding frenzy by the smell of blood. Their teeth are so sharp that they can strip a 100 pound animal to the bone in a minute. No telling what they could do to a person unlucky enough to go for a swim at the wrong time! Large electric eels live in tropical rivers. Their bodies can generate enough electricity to knock a person senseless and, in some cases, can cause drowning. "Shocking" ... but true. Anacondas can even swallow a crocodile. The anaconda is a water boa and it is the largest snake in the world at 37.5 feet long and weighing over 500 pounds. They've been known to eat people now and then, although they don't make a regular diet of humans. Boa, oh boa that's a lotta snake! In every rain forest there are many kinds of plants. Many, many, many kinds of plants. In fact, inside a single hectare (2.47 acres) you can find up to 750 types of trees and 1,500 types of plants! But this entire range of species can easily be broken down into four categories, grouped by how they
Tuesday, March 3, 2020
How Many Questions Can You Miss for a Perfect SAT Score
How Many Questions Can You Miss for a Perfect SAT Score SAT / ACT Prep Online Guides and Tips Every year about 500 students get a perfect score on the SAT. How many questions can you get wrong and still be among this elite group? Find out here in a complete breakdown ofthe Math and Evidence-Based Reading and Writing sections across eight official SAT practice tests. How Is the SAT Scored? To understand how many questions you can get wrong and still achieve a perfect 1600, you need to understand how the test is scored. I'll give a brief summary here, but if you're interested in more details about the scoring process, check out ourguide onhow to calculate SAT score. For the whole test, you receive one point for correct answers, and you receive zero points for a wrong answer and questions skipped. Since youââ¬â¢re not penalized for wrong answers, skipping or answering a question incorrectly results in the same score. NOTE:The essay is not factored into your composite SAT score (400-1600 scale), so I will not discuss it further in this article. However, for more information on the new SAT essay, read our other guide. To calculate your Math section, you start by calculating a raw score, which is simply the number of questions answered correctly (if you answered 50 correctly, your raw score is 50). For the Evidence-Based Reading and Writing section, you start by calculating two raw scores: one for the Reading portion and one for the Writing and Language portion. Just as in the Math section, the raw scores are just the number of questions answered correctly. For both sections, each raw score is then converted into a scaled score - the exact conversion varies by test date. However, the College Board provides this example chart intheir SAT practice testas an estimate: Let's go through how the scoring works for each section in a bit more depth.For Math, the raw to scaled score conversion is very simple. Letââ¬â¢s say you miss two questions (you got 56 correct out of 58 questions); your raw score will be a 56. You then find the corresponding scaled score for Math on the chart, which is 790. Your Math section score would be a 790. For Evidence-Based Reading and Writing, the conversion is a little more complicated since you get two raw scores. If you missed three questions in Reading (got 49 of 52 correct), your raw score would be 49. If you missed ten questions in Writing (got 34 of 44 correct), your raw score would be 34. You then find the corresponding scaled score for each of those sections: Reading: 49 questions right = 38 scaled score Writing: 34 questions right = 32 scaled score Next, you add together the two separate scaled scores and multiply by 10 to get your Evidence-Based Reading and Writing section score. (38 + 32) x 10 = 70 x 10 =700 Your Evidence-Based Reading and Writing section score would be 700.Now letââ¬â¢s get back to the original question. Exactly How Many Questions Can You Get Wrong or Skip and Still Get a 1600? Since the scores on the individual sections are simply added together to create your composite SAT score, you need to score 800 on the two sections (Math and Evidence-Based Reading and Writing) to get a score of 1600. In the chart below, I have analyzed eight official SAT score charts and determined the number of questions you can get wrong or skip on each part of the test for an 800 in the section. These official practice SAT were written by the same people who write actual SATs. This means they're a great resource for analysis because you can be sure they'll be very similar to the SAT you take on exam day. NOTE: Since youââ¬â¢re not penalized for wrong answers, skipping vs. answering a question incorrectly results in the same score. Number of Questions You Can Get Wrong in Each Section and Still Get a Perfect Score Math Reading Writing Total Test 1 0 1 0 1 Test 2 0 0 0 0 Test 3 0 1 0 1 Test 4 1 0 0 1 Test 5 0 0 1 1 Test 6 0 1 0 1 Test 7 0 0 0 0 Test 8 1 0 0 1 Typically, to get an 800 in Math, you cannot miss any questions because you need to get a raw score of 58 (out of 58 questions). Occasionally, an SAT will allow you to get one wrong answer in Math as you can see on Tests 4 and 8. However, I would not count on that, as it is not the norm. If you're aiming for 1600, strive for perfection in Math. To get an 800 in Evidence-Based Reading and Writing, you cannot get any questions wrong on the Writing and Reading portions. Occasionally, an SAT will allow you to get one wrong or to skip one as you can see on Tests 1, 3 and 5 for the Reading section, or Test 5 for the Writing section. However, as with Math, that is not the norm. If you're aiming for 1600, prepare to get zero wrong in Evidence-Based Reading and Writing. Overall, on the SAT, you should aim to get no questions wrong if you want a perfect score.This is no easy feat, but it is possible. After all, about 500 students do it each year! What Does This Mean If You'reTrying to Get a 1600? You need to make sure that you can finish the entire test in the allotted time since you cannot afford to skip or miss any questions. For Math, you need to be basically perfect. You can see, through my analysis, on six out of eight Math sections, you cannot get any questions wrong if you want an 800. For Evidence-Based Reading and Writing, you also need to be basically perfect. On three out of eight Reading portions, you could get one wrong and still get 800, but you canââ¬â¢t rely on having that opportunity. On seven out of eight Writing sections, you cannot get any questions wrong if you want an 800. What's Next? Trying to get a perfect SAT score? You should check out our SAT study guide. Taking the SAT soon and need to improve your score in a hurry? Read our SAT cramming guide. Aiming for the Ivy League? Read our guide to getting in! Want to improve your SAT score by 160 points? Check out our best-in-class online SAT prep classes. We guarantee your money back if you don't improve your SAT score by 160 points or more. Our classes are entirely online, and they're taught by SAT experts. If you liked this article, you'll love our classes. Along with expert-led classes, you'll get personalized homework with thousands of practice problems organized by individual skills so you learn most effectively. We'll also give you a step-by-step, custom program to follow so you'll never be confused about what to study next. Try it risk-free today:
Sunday, February 16, 2020
Negative or Bad News Assignment Example | Topics and Well Written Essays - 500 words
Negative or Bad News - Assignment Example At this point of time, we cannot hand over speakership to Ms Rivera because her technology is different from what we want to highlight in this session of Annual Conference. So we can say that specifically we have to refuse Ms Rivera about her request. It might be possible that Ms Rivera will think that we do not value our working relationships. She may also feel that her sacrifices for our company had no worth at all. She will feel down and negative about the company because she is very much willing to promote her latest technology in the High Tech Annual Conference. It can be expected that Ms Rivera will not be on the same good terms after this refusal just because we are not agree to give her company the speakership of the Annual Conference. In our case, the primary audience is Maribel Rivera, the owner of another manufacturing company who is supporting our company and this Annual Conference from last 8 years. She is always there for handling any problem. She even took the responsibility of a presentation at the last moment when one of our presenters refused to take part in the conference in the last yearsââ¬â¢ conference. It may be possible that this message will put a negative effect on our good and sound relationships. In addition to it, it is also possible that she will not attend our Annual Conference for the appreciation of technology. In order to minimize the negative impact of the message, it is quite necessary to communicate the actual reason of refusal of request in a sugarcoated manner, so that the working partner may not feel bad for it. We need to inform them about the main idea of the High Tceh Annual Conference of this year i.e. we are focusing on the Robotics and Technological interventions in medical fields. Another highlight should be the purpose of grabbing the national and international media attention. We can also tell her that if she would participate in the conference then it is quite possible that her technology is
Sunday, February 2, 2020
America Essay Example | Topics and Well Written Essays - 1250 words
America - Essay Example This Constitution is the supreme law which governs the U.S.A. in all aspects of the political arena, be it be the legislative, executive or judiciary. This Constitution is the landmark legal document of U.S.A. which oversees all affairs. Changes in the constitution can have a lot of repurcussions for the countrymen. It determines the rights of every citizen, be it be a minority or a Black. It was in effect from 17th September 1787 in Philadelphia. Being the oldest Federal constitution in existence, we can expect it to have been amended the most with changing times. It has been in subsistence for long and the affect of many shifting eras would be prominent in it. The Founding Fathers are those who framed the constitution and had a say in the Declaration of Independence. The Forefathers were a figure of 55 men who represented the great leadership that America received in the 18th century. Each one of them was a prominent and important inidividual in their own sphere. They all were well-educated and had been participating actively in national affairs. Drafting the constitution was no minor responsibility. They put all their energy and brains in coming up with the best possible constitution. Whether it was the Revolution or the U.S. Army, most of them had powerful positions of command in these areas. Their far-reaching political experience and the sweat they put in making the Constitution would make them reluctant to accept changes in it. But the number of editions and supplements that are now available of the United States Consitution speaks loud and clear that the Founding Fathers would definitely be hit with ground-breaking realities of chan ging times and the resultant mould of their dear Constitution. THE CONSTITUTION AS THEY MADE IT The Constitution was laid down with seven major articles, one each for legislative power, executive power, judicial power, states' powers and limits, process of amendments, federal power and ratification. Whether it was the manner of elections or the qualifications for office, the kinds of cases that may be heard by the federal judiciary or the relationship amongst the states, the process needed to go through for amendments in the Constitution or the amount of federal power in the hands of the leaders, the requirements for ratification of the Constitution the Founding Fathers had decided it all! Even the people of the past knew that amendments cannot be avoided. However, they did not want the change process to be too easy for hastening and unplanned changes to take effect. CHANGES THAT WOULD SURPRISE THEM! After the original Constitution was passed, there were a total of 27 amendments in it. These amendments were aimed at changing various aspects of the political scene, such as controlling the scope of federal power or the method of presidential elections.BILL OF RIGHTS The first ten, collectively, came to be known as the Bill of Rights and was promulgated between 1789 and 1791. They all are concerned with decreasing and restricting the power of the federal Government. As the Bill of Righ
Saturday, January 25, 2020
Immune System of a Plant
Immune System of a Plant ABSTRACT Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial fungal relations. INTRODUCTION The Microbiome Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins. Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà a, 2013) In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011). Plant Immune Response The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI). This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR. NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013). Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012). FHY3 FAR1 Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003). Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA. (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5 all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression providing a possible linkage between light signalling and plant immunity. Next Generation Sequencing Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009). Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016). Predictions A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest particularly when it comes to micro biotic resistance. (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007). Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana. Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms. Materials and Methods Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA. Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164 à µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK). Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10 à µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65à °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20 à µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65à °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37à °C and resuspended in sterile deionized water for a final volume of 500 à µl. DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB. PCR for High-throughput Sequencing and Sequencing Analysis PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20 à µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200 à µM dNTPs, 0.2 à µM forward primer, 0.2 à µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1 à µl colony suspension and distilled water. To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used. Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA. Data processing Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial and fungal reads), a method had to be devised to separate them. SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence. A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed. Statistical analysis For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011) Results Statistical Analysis of Bacterial Communities Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1. Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter. Discussion Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes. To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci d. Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi. Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings. We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ãâ¦Ã azà ´niewska, 2010), however some literature contradicts our findings. Bacterial community diversity is increased in fhy3 far1 A. thaliana Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment. The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR) a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin
Friday, January 17, 2020
Analysis of Myth of Total Cinema: Bazin
The Myth of Total Cinema Andre Bazin in his article, The Myth of Total Cinema, asserts that motivation behind cinema is realism. He explains his theory by examining the technology of cinema. He argues that cinema was not born from the technology advancement but rather from innate desire to reproduce the realism of our world. ââ¬Å"The basic technical discoveries [are] fortunate accidentsâ⬠¦ essentially second in importance to the preconceived ideas of the inventorsâ⬠(Bazin, 200). What Bazin means is that the invention of technology was not to gain profit rather to replicate and reproduce our real world on screen.Though he does argue that some were in it for the profit of the technology. Inventors of photography and cinema thought about what they will show and reproduce primarily to how they will achieve the reality of the world. In another words, the essential drive to reproduce the real led to the production of technology. The desire for realism did not come from the prod uction of technology. Bazin goes on to explain that our understanding of cinema should not derive from the technology but from the reality that is perceived through the reproduction. Related article: Odeon Cinema PestleBazin goes on to state that: ââ¬Å"The guiding myth, then, inspiring the invention of cinema, is the accomplishment of that which dominated in a more or less vague fashion all the techniques of the mechanical reproduction of reality in the nineteenth century, from photography to phonograph, namely an integral realism, a recreation of the world in its own image, an image unburdened by the freedom of interpretation of the artist or the irreversibility of timeâ⬠(Bazin, 202). What he is trying to elucidate is that the guiding myth of realism and cinema should be the production of cinema unburdened by an artistââ¬â¢s interpretation or subjectivity.It also means that the time is not restricted. In addition Bazin continues, ââ¬Å"The real primitives of the cinema, existing only in the imaginations of a few men of the nineteenth century, are in complete imitation of natureâ⬠(Bazin, 202). He is stating that a real cinema is established by t hose who dream of cinema as a replicate of nature. Bazin concludes that the myth of total cinema is ââ¬Ërealismââ¬â¢, and that it has been a part of every man before invention of technology. Bazinââ¬â¢s article is very interesting and reasonable but his arguments only justify one side of the story.Cinema is not only a tool for reproduction of nature but also an apparatus for fantasy and dreams. It can be argued, I too agree, that the development of technology was created for the purpose of recreating nature, but the development of technology has advanced artistically. This artistic development of technology has aided many in creating their imagination that are beyond reality. For example, the film, Inception, contains scenes that are impossible to film in reality. Scenes containing upside buildings, never ending stairs, buildings crumbling and etc. are very difficult to accomplish without the help of the advancing technology. Yet the advancing technology has made it possibl e to create the impossible. What I am trying to say is that the story of Inception was not created prior to the advancement of technology but after. The story of the film was thought out with the possibilities of the technology in mind. Bazin maybe correct in stating that cinema was essentially the instinctive drive of human desire to reconstruct and imitate reality though we can argue that it is not the ââ¬Ëonlyââ¬â¢ drive of cinema.
Thursday, January 9, 2020
Testing and Applications of Composite Materials - Free Essay Example
Sample details Pages: 4 Words: 1293 Downloads: 5 Date added: 2019/03/18 Category Analytics Essay Level High school Tags: Characterization Essay Did you like this example? Youngs modulus is an important giveaway of the materials capabilities to withstand changes in the length of its specimen when a stress is applied along its length, whether it is compression or elongation. This valuable information is crucial in making decisions about which composite material is suitable for what application. Therefore, the combination of DIC and FEA methods analysis is a great approach if one wants to obtain a stress-strain curves that include fracture strain in a composite material, which makes the determination of Youngs modulus very easy.[4] Tensile testing proves to be one of the most successful traditional methods of testing for composites strength and its corresponding characteristics. However, not every composite material can be tested equally and under the same experiment setup. Namely, the type of reinforcement of a composite material plays a great role in this determination. If one recalls that there are continuous and discontinuous fibers used for reinforcement, it is important to remember that when the continuous fibers are used, the material obtains unidirectional properties, meaning that the properties of the material are specifically oriented to one location. Different properties are obtained after applying loads in different directions; along, across and normal to the direction of the fibers. Because of these characteristics, unidirectional composites are challenging to test under tensile testing. Namely, the traditional clamps for tensile testing used to hold the specimen in place may induce unwanted stress es at the clamped specimen areas, which will disrupt the experiment results and accuracy of the further results analysis. This paper proposes several ideas on how to improve the existing setup for tensile stress testing. One recommendation is to use a thin specimen for testing in order to reduce the stress concentration across the depth of the specimen, reducing numerically any unwanted induced stresses. However, it is important for the specimen to still retain the original material properties, meaning that one needs to carefully choose the minimum depth that one wishes to test. This approach requires more details and information about the tested composite, specifically the minimum thickness of the specimen that can successfully represent the materials properties. Another recommendation is to use longer clamps in order to have uniform stress distribution over a bigger part of the specimen area, meaning that the stress concentration will not be contained only in a small outside area of the specimen. This approach is somewhat limiting as it will leave a very small specimen area that can be actually tested. Lastly, this paper indicates that American Society for Testing and Materials (ASTM) has suggested a different approach as a solution to this issue. ASTM suggestion is that if the clamps used for tensile testing are made of the same material as the composite, the induced stresses will be minimized. This approach has proven to be successful in several experiments, but it can be limiting to experiments where the specimen composite is relatively weak and not well bonded or reinforced. For most common applications, such as high-performance applications, this would not be the case, so the approach will be valid. [5] Donââ¬â¢t waste time! Our writers will create an original "Testing and Applications of Composite Materials" essay for you Create order After reviewing several existing testing methods, this paper suggested a new method for testing the composite materials for their strength characteristics. Namely, this experiment will test the composite under fatigue and static loadings. The main concept behind this experiment is to keep the end-to-shear load ratio constant along with the load translation. This is possible by using a specific mechanism that is able of controlling a gripping pressure of the loaded specimen. The main idea behind this experiment setup was a great success of a similar experiment used for static loading; now, a similar but significantly updated setup will be used for fatigue load testing. The clamps and several other fixtures that are used to secure the specimen in place were updated and advanced so that the experiment results are not influenced by a specimen slipping from the frame or by having clamps slide over the specimen surface. This modification from previous tests allows for accurate results of t he fatigue strength. By keeping the end-to-shear ratio constant, the test can be repeated for several trials (or cycles) in order to yield different fatigue strengths that will help in creating a strength model specific for the composite material in question. Fatigue strength, also known as endurance limit, is a value of the stress that a material specimen can endure for several trials (or cycles) without breaking apart. By performing a specified number cycles of testing with different strength values, one can expect to have the specimen fall apart, as the strength and hardness of the composite material will decrease with the increase of cycles. Obtaining the highest possible stress values that a material can withstand for a specific amount of time is a very valuable and important piece of information to know when making decisions about which composite material to attribute to a given application. If the application for which the material is intended requires a strong material that can withstand many stresses applied over time (for example, bolts of the lawn mower must have high endurance because of the constant vibrations coming from the mower), choosing a strong material is crucial. However, applications that do not require extremely strong materials used can be performed with a lower-cost composites that will satisfy the required performance and be cost-effective at the same time. The above described method is, therefore, very useful in the analysis and categorization of the composite materials for various applications. Such experimental setup yields accurate fatigue strength results, which greatly help in making cost-effective decisions. [6] Several testing methods for composites have been explored and presented, but if one thinks in terms of applying them to every kind of composite available, a question arises: all of these methods mainly rely on applying force to the specimen, so how can a brittle composite specimen be properly tested? Many of the current methods do not allow or may not be suitable for low force applications and testing, so some new methods must have been introduced. One of them is a Modified Short Beam Shear specimen, also known as MSBS. This specimen is used to suitably test brittle specimens for their interfacial or attachment strength. This specimen is made as a sandwich of two reasonably thick aluminum plates and the brittle composite that is supposed to be tested is laying between them. This setup allows for safe and accurate measurement of the strength of the composite material in question. One of the most brittle composites are made of thermosetting vinylester resin that is reinforced with carb on tubes (multi-walled), also known as MWCNT. This sandwiched configuration allows for this brittle composite to be properly tested and explored for its strength characteristics. However, this setup does not produce a pure shear stress state in the composite, but the result is still applicable since the characteristics of this type of composite can be altered with chemical additions and changes. The whole experimental setup post-analysis is performed by using a finite element analysis method. This allows for the experimental results to create a suitable model that can be applied throughout different scenarios where this composite is being used. The failure mode is also a combination of normal and shear stresses, which is a typical testing result for very brittle composites like this one. Overall, this setup provides for a safe and experimentally successful environment in order to test composite materials for their strength properties even if they are categorized as highly brittle co mposite materials. Although this test specifically refers to thermosetting vinylester resin that is being reinforced with multi-walled carbon nanotubes (MWCNT), considering the success of this experimental method, it is worth exploring if it will be applicable to other composite materials of the same or even higher level of brittleness.[7]
Wednesday, January 1, 2020
Abstinence Only Education Is The Most Prevalent Form Of...
Abstinence only education has been the most prevalent form of instruction in middle and high school courses for years in the United States. Instead of providing accurate scientific facts, it has been primarily based on ideology and what has been traditionally morally accepted: sexual activity within a heterosexual marriage. As a result, teenagers have been taught through biased information influenced by current heteronormative standards. Consequently, abstinence only education fails to acknowledge the minority populations of teenaged students who are different genders and sexualities other than a heterosexual male. Realistically, it can be inferred that a majority of the student bodies in America are rich in diversity. The classroom is no longer composed of homogenous individuals. Instead, classrooms are full of adolescents of various genders, sexualities, ages, and ethnicities. Abstinence only education strictly instructs through biological and reproductively compatible terms rather than addressing other methods of having sex, specifically pertaining to the LGBTQ community. The current curricula typically teaches that penile-vaginal sex is the ââ¬Å"properâ⬠way to have intercourse and that it is customary that sex occurs only between a man and a woman. Thus, emphasizing how genitalia should be used rather than having a more holistic approach towards sex. Ultimately, this disregards all of the possible mechanisms that exist when it comes to physical touch. As a consequence,Show MoreRelatedShould Sex Education Be Incorporated Into Public Schools?1372 Words à |à 6 PagesFor Sex Education in Public Schools An observation of the prevalent television programs and popular topics broadcasted in the media often depict teenagers with an air of promiscuity. Is teenage pregnancy really an uncontrolled epidemic, as depicted in shows such as ââ¬Å"16 and Pregnantâ⬠? Are a vast majority of teenagers exchanging racy photos of their bodies with each other? If so, are teenagers acting out because of too much sex education? Or is the outbreak of hyper-sexualized activity linked to lackRead MoreThe Controversial Issue Of Sex Education965 Words à |à 4 PagesIn the early 1960ââ¬â¢s the controversial issue of sex education started to become a more prevalent conversation among educators and parents alike when the Food and Drug Administration approved the sale of oral contraceptives(Szustek, 2009). Though the topic was previously being discussed as early as mid to late 19th century, it was not deemed completely necessary or an appropriate topic for school aged children prior to this point. In t he United States more than 750,000 girls between the ages of 15-19Read More Sex Education in School Essay1706 Words à |à 7 Pagescases grade schools. As the saying goes monkey see monkey do one can only assume that this concept will pertain to these easily influenced children. That is why it is imperative that another side of this issue is presented on a regular basis, a side that demonstrates safe sex as well as no sex. Sex is a basic instinct in all-living beings; sex education in Georgia public schools should encourage abstinence because it is the only sure way to prevent pregnancy and disease, but not dismiss protectiveRead MoreFree And Accessible Birth Control1722 Words à |à 7 PagesFree and Accessible Birth Control in the United States A total of 730,322 abortions were reported from the Centers for Disease Control in 2011. This could easily be resolved with proper usage of birth control. But the fact of the matter is that only 62% of women are actually using proper birth control, now this may seem like a lot of women, but there is 158.6 million women in the United States alone so 58.5 million are currently not on any birth control which is a huge amount of women. Birth controlRead MoreThe Latino And Latino Culture Health Care1397 Words à |à 6 Pagesteen age pregnancy are significantly more prevalent in Hispanic/Latino population as well. Rate of vaccination is also below that of the majority of the population. Addressing their health care makes good public health and economic sense. Reasons for this discrepancies are many and varied, so different and varied approaches will be needed. In the Hispanic/Latino culture health care is most commonly sought after when symptoms appear, and in may cases only when those symptoms cause the individualââ¬â¢sRead MoreEssay about Sex Education in School4599 Words à |à 19 PagesSex Education in School Just say no, or say nothing at all. Either live by the word of the Christian God, or live with disease and unsupportable families. In current abstinence-only sexual education, this is the choice the nation gives to young people about their private sexuality. Clear concise facts have given way to horrifying lectures of the fictional evils of sexual behavior that falls outside the lines drawn by the right wing and the Pope. These tactics do not educate and only damageRead MoreA Constitutional Amendment: the Only Way to Protect Parental Rights to Direct the Upbringing and Education of Their Children3083 Words à |à 13 PagesA Constitutional Amendment: The Only Way to Protect Parental Rights to Direct the Upbringing and Education of Their Children English 1020 May 1, 2008 Outline Thesis: In order to ensure that parental rights concerning the upbringing and education of their children remain fundamental rights in America, there must be an amendment to the United States Constitution explicitly stating parental rights. I. Parental rights are not specifically protected under the United States ConstitutionRead More The Impact of Lowering the Drinking Age on State University Essay4145 Words à |à 17 Pages The legal drinking age in the United States will always be a point of contention. No one can settle upon a drinking age that everyone is in agreement with; should it be 18 or 21? Ages 18 and 21 are the most popular options, yet neither one has 100% of the vote. With the current legal drinking age in America standing at 21, meaning that people under the age of 21 cannot purchase or consume alcoholic food or beverages, there is the question of whether or not to lower it to 18 or 19 years oldRead MoreHiv/Aids Summary of Research Study8804 Words à |à 36 Pagestime of case reporting. Sexual contact was the most common mode of HIV transmission, accounting for 93% (799) of all reported AIDS cases. The number of HIV cases continues its upward trend, with the latest figure in January 2011, there were 152 new HIV Ab sero-positive individuals confirmed by the STD/AIDS Cooperative Central Laboratory (SACCL) and reported to the HIV and AIDS Registry. This was a 6% increase compared to the same period last year. Most of the cases (93%) were males. In the PhilippinesRead More Drug Abuse Among American Teenagers Essay7972 Words à |à 32 Pagesthat teenagers use range from Alcohol, LSD, Marijuana, and even Cigarettes. Most of the teenagers that are involved in drug abuse have either, broken families, parents that are drug abusers, a unstable environment where they are constantly moving from place to place, or there parents arent exactly making a lot of money and they are never around because they are trying to make enough money for them to survive. But even to most ordinary teenager can have a drug problem depending on there friends, and
Monday, December 23, 2019
Macbeth by William Shakespeare - 541 Words
Macbeth, his journey begins as a noble soldier. Whose sole purpose is to protect king and country. However we will see him go from this noble hero to a very power crazed, prideful murder. This journey begins with a soldier named Macbeth he is away defending his country. Macbeth finds himself being a very successful soldier, he easily captures the enemy. After capturing his target, he kills him by slitting him nave to chin. The king of Scotland Macbeths cousin is very impressed with Macbeth and gives him great praise! Having defeated the enemy we find Macbeth running into three witches who tell him his future. Macbeth is ready to make these predictions come true. This is where we see pride sneak in and begin its path of destruction in Macbethââ¬â¢s life. He was told he would be king and now he wants it and so does his wife. We see Lady Macbeth scheming and setting everything up so Macbeth can kill the king. However Macbeth loves the king and doesnââ¬â¢t want to do this act. So we see Lady Macbeth use emotional black male and pride saying when you durst do it, then you were a man (tragedy of Macbeth act 1 scene 7.). Macbeth canââ¬â¢t handle being belittled his prideful heart takes over, he does it he kills the king. Now the king is dead but Macbeth is still very worried that King Duncanââ¬â¢s sons will take the throne. Morning comes and the king is found dead, in an act of fear Duncanââ¬â¢s sons flee Macbeths home, and head in two separate directions. Macbeth now reigning king becomes paranoid.Show MoreRelatedMacbeth by William Shakespeare770 Words à |à 3 PagesThe play Macbeth is written by William Shakespeare. It is believed to be written between 1603 and 1607 and set in eleventh century Scotland. It is also believed to be first performed in 1606. It is considered to be one of the darkest and most powerful tragedies. Macbeth, set in Scotland, dramatizes the psychological and political effects produced when evil is chosen to fulfill the ambition of power. The Tragedy of Macbeth is Shakespeareââ¬â¢s shortest tragedy and tells the story of Macbeth, a ScottishRead MoreMacbeth, By William Shakespeare1425 Words à |à 6 PagesMacbeth Just Canââ¬â¢t Wait To Be King Everyone has a quality that they do not like about themselves. Some people struggle to be social, others may be too controlling of people. The list goes on and on, but the point is that everybody has a particular quality that they must learn to control or else that particular quality can get out of hand. Of course, one could write a list of characters that have major flaws. There is no better example than William Shakespeareââ¬â¢s character, Macbeth, in The TragedyRead MoreMacbeth, By William Shakespeare1409 Words à |à 6 Pages ââ¬Å"Fair is foul, and foul is fair: Hover through the fog and filthy air.â⬠On October 17th, I had the pleasure of going to see Macbeth performed at the Shakespeare Tavern. Along with its reputation for being ââ¬Å"cursed,â⬠Macbeth is also known as one of the crown jewels of William Shakespeareââ¬â¢s repertoire. In my opinion, the central concept of this particular retelling of the play was the murkiness of character. Throughout the pla y, the many characters go through fierce temptation and strife, and noneRead MoreMacbeth, By William Shakespeare1203 Words à |à 5 PagesMacbeth is a play based on King James I, it was written by William Shakespeare, however this play isnââ¬â¢t a king and queen fairy tale, but itââ¬â¢s a play about greed and guilt, chaos and murder and three evil witches who use prophecies to influence Macbeth to do bad things, using flattery would instigate his inner ambition to become king, which in the end doesnââ¬â¢t lead to a very happy ending. Shakespeareââ¬â¢s, Macbeth, was written in the early Jacobean period. During those times, women had no power, theyRead MoreMacbeth, By William Shakespeare1243 Words à |à 5 PagesIn William Shakespeareââ¬â¢s ââ¬Å"Macbethâ⬠, the author portrays the main character Macbeth as a very tortured and flawed individual whose actions only serve to further unravel him. He is conflicted and power hungry, which drives him to perform evil murders and become a ruthless person. Macbethââ¬â¢s moral compass is not resilient enough to withstand his wifeââ¬â¢s manipulations and he is provoked to act on his malicious thoughts of murder. The author explores the terrible effects that ambition and guilt can haveRead MoreMacbeth, By William Shakespeare Essay1487 Words à |à 6 Pagesreactionâ⬠. Macbeth by William Shakespeare is a tale which illuminates the consequences of violating the ââ¬Å"Natural orderâ⬠, the hierarchy of beings in the universe. When Macbeth, a warrior wel l-known for his courage and bravery, murders King Duncan acting on his unchecked ambition to claim the throne, the order was disrupted, the resultâ⬠¦chaos. Shakespeare uses symbolism to illustrate the atmosphere of the play as the natural order is flung into a state of turmoil. These techniques used by Shakespeare is usedRead MoreMacbeth, By William Shakespeare1483 Words à |à 6 Pagesdifferent references in the play of how a king deals with power and if they use it for better or for their own personal gain. In the play Macbeth, by William Shakespeare, Macbethââ¬â¢s obsession with his journey to power leads to his failure. This obsession is demonstrated through the prophecies, the murder of his best friend Banquo, and his own demise. Macbeth demonstrates that he is incapable of mastering the power and responsibilities of being a king. This is indicated throughout the play with theRead MoreMacbeth, By William Shakespeare1045 Words à |à 5 PagesBlood appears in only two forms, but many times in Macbeth by William Shakespeare; between the war scene at the beginning of the play and the lifting of Macbethââ¬â¢s severed being lifted by Macduff at the end. It can be said that Macbeth could have been written in blood that there is such a large amount. What is unique about blood in Macbeth is that the ââ¬Å"imaginary bloodâ⬠or the guilt that the murderer feels plays more of a role of understand and amplifying the theme of the play, that blood is guiltRead MoreMacbeth, By William Shakespeare1431 Words à |à 6 Pages Macbeth, though originally a valiant and prudent soldier, deteriorates into an unwise king whose rash decisions conclusively end in the atrophy of his title, power, and position. Several facto rs contribute to the downfall of Macbeth, which produce a contagion effect and ultimately end with his demise. He receives help from his ââ¬Å"inner ambitions and external urgingsâ⬠which result in his downfall (Bernad 49). The ââ¬Å"external urgingsâ⬠consist of the weird sisters who disclose his prophecies, which enlightenRead MoreMacbeth, By William Shakespeare2060 Words à |à 9 Pagesthe green one red Macbeth Quote (Act II, Sc. II). Out, out, brief candle! Life s but a walking shadow, a poor player that struts and frets his hour upon the stage and then is heard no more: it is a tale told by an idiot, full of sound and fury, signifying nothing. Macbeth Quote (Act V, Scene V). These quotes have been taken from play Macbeth written by William Shakespeare. Like these quotes there are hundreds and thousands of such heart touching quotes written by Shakespeare in his many different
Subscribe to:
Posts (Atom)