Saturday, January 25, 2020
Immune System of a Plant
Immune System of a Plant    ABSTRACT  Two light signalling factors, FAR-RED ELONGATED HYPOCOTYL3 (FHY3) and FAR-RED IMPAIRED RESPONSE 1 (FAR1) regulate chlorophyll biosynthesis, seedling growth and modulate plant immunity by controlling HEMB1 expression in Arabiopsis thaliana. We show that fhy3 far1 double null mutants display high levels of reactive oxygen species, salicylic acid and high expression of pathogen related genes. We analyse the effects of this constitutively activated immune response on commensal microbial communities through use of a next generation sequencing based approach. We determine that fhy3 far1 mutants contain greater species diversity and a greater resistance against pathogenic bacteria. Fungal pathogens increase in abundance in fhy3 far1 mutants. Taken together, this study demonstrates the important role of FHY3 and FAR1 in commensal microbial community composition as well as the importance of bacterial  fungal relations.    INTRODUCTION  The Microbiome  Microorganisms are an extremely diverse group of organisms; making up an astonishing 60% of the Earths total biomass (Singh, 2009). Soil sustains as many as 4-51030 microbial cells (Singh, 2009), all contributing to soil structure formation, decomposition, and recycling of organic matter into its constituent elements and nutrients. Microorganisms present in the soil adjacent to plant roots are part of the Rhizosphere. (Garbeva, 2004) highlights their pivotal roles in the suppression of plant disease (Badri DV, 2009), promotion of plant growth (Lugtenberg, 2009), development and health (Mendes, 2011). Leaves usually dominate the aerial part of the plant, representing of the most significant terrestrial habitats for microorganisms: the Phyllosphere (Vorholt JA, 2012). A diverse community of bacteria and fungi inhabit this challenging habitat; with nutrient deficiency and fluctuations in temperature, humidity and UV radiation (Lindow SE, 2003). The microbial communities here are shaped    by biotic factors: (Yang CH, 2001) states that species, genotype (van Overbeek L, 2008) and age of plant (Redford AJ, 2009) all have their respective impacts. Abiotic factors also have a profound influence over the communities present within the phyllosphere. Plant location and growth conditions such as soil composition and climate can also have a strong impact due to the physiochemical alterations they impart. (JH, 1999) also notes how plant genotype and phenotype has an impact on community assembly. Although the majority of communities exist on the plant surface, and are therefore epiphytic  some exist within the plant as endophytes. Species present within the phyllosphere tend to assimilate plant derived ammonium, simple carbohydrates and amino acids, which are their primary nitrogen and carbon sources (Thomas R Turner, 2013). Microorganisms energy metabolism isnt entirely dependent on the plant; some species contain rhodopsins.  Due to the abundance of processes which play a role in community composition (Weiher E, 2011), phyla with the best adaptations for survival and reproduction tend to predominate communities. These microorganisms can promote plant growth through the production of hormones, or protect plants from pathogenic organisms by producing antibiotic compounds, competing for resources (Berg G, 2009) or induction of systemic resistance (Conrath U, 2006). The use of Arabidopsis thaliana as a model organism has been vital for these studies (Innerebner G, 2011). A. thaliana is an annual forb, occurring at temperate regions worldwide in a diverse range of habitats (Elena Garcà a, 2013)  In order to analyse microbial communities; a few terms need to be defined. Biodiversity is defined as the range of significantly different types of organisms and their respective relative abundance within a community, encompassing three main levels; genetic variation between species, number of respective species and community or ecological diversity (Harpole, 2010). Two main components make up species diversity: the total number of species present (species richness) and the distribution of individuals amongst said species (evenness). Operational taxonomic units (OTU) or communities provide information on an ecosystem (Mannan, 2013). Species diversity relates to the stability of a community; well organized communities tend to have the greatest stability (Yannarell, 2005). Stresses can cause disturbances in a homeostatic community, thereby disrupting it and leading to changes in species abundances. When characterizing an ecosystem such as A. thaliana, one must determine three things: T   he type of microorganisms present, their roles and how these roles relate to the ecosystems function (Sani, 2011).  Plant Immune Response  The immune system of a plant has a selective effect upon its microbiome. Upon pathogen encounter, a plant will elicit an immune response with the goal of limiting pathogen growth. Biotrophic and hemibiotrophic pathogens (those who obtain nutrients from living host tissue) are repelled by Salicylic acid dependent defence responses. Necrotrophic pathogens (which kill their host to obtain nutrients) are sensitive to Jasmonic acid (JA) and Ethylene (ET) dependent defence responses (Christine Vogel, 2016). Plants lack specialised immune cells; therefore, their cells must have an ability to sense pathogens and mount an appropriate immune response. Pathogens are detected by pattern recognition receptors (PRRs) which bind to the microbe or pathogen associated molecular patterns (MAMP/PAMP), thereby issuing a layer of basal defence known as PAMP triggered immunity (PTI) to prevent pathogen colonization (Chuanfu An, 2011). In order for pathogens to cause disease, they must inject effectors int   o plant cells, thereby interfering with PRR complexes or downstream signalling to overcome the PTI. Plants have evolved resistance proteins which recognise effectors directly or indirectly and induce effector triggered immunity (ETI).  This response is far more specific, and is often followed by a hypersensitive response (HR). R proteins, mostly leucine-rich repeat (LRR) domain containing proteins and Nucleotide-binding (NB) proteins are the intracellular receptors which sense pathogen derived molecules (Heidrich K, 2012). Figure 1 shows a summary of these processes. When these proteins are activated, production of salicylic acid occurs. Salicylic acid (SA) is a phenolic phytochrome present in plants. SA holds roles in growth, development, transpiration, photosynthesis and the uptake of ions. Its also vital for the process of endogenous signalling, mediating plant defence against pathogens. Activation of defence signalling pathways causes the generation of mobile signals from the infected tissue, where they can spread to distal tissue. Here they can upregulate expression of pathogenesis related genes and induce systematic acquired resistance (SAR), a long-lasting immunity against a broad spectrum of pathogens. Sali   cylic acid mediated immune responses are important factors of both PTI and ETI, essential for the activation of SAR.  NB-LRR mediated disease resistance may only be effective against pathogens grown on living host tissue such as obligate or hemibiotrophic pathogens, but not against nectrotrophs (Dangl, 2006). Downstream of the NB-LRR R proteins, the pathways ENHANCED DISEASE SUSCEPTIILITY1 (EDS1) and its partner PHYTOALEXIN DEFICIENT 4 (PAD4) act in basal resistance and ETI initiated by Toll-like/Interleukin 1 receptor (TIR) type NB-LRR R proteins (Vlot AC, 2009). Both PAD4 and EDS1 amplify SA signalling through a positive feedback loop (Wanqing Wang, 2015). Coiled-coil (CC) type NB-LRR proteins are regulated by NONSPECIFIC DISEASE RESISTANCE 1. When SA levels increase as a result of pathogen challenge, redox changes are induced which cause reduction of NON EXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1) to a monomeric form which activates defence responsive gene expression by accumulating within the nucleus. This results in plant immunity (Fu ZQ, 2013).  Most bacteria which colonize A. thaliana are not pathogenic however still produce MAMPs. It is currently not known how plants are able to tell apart pathogenic and commensal microorganisms, and whether the recognition of these non-pathogenic phyllosphere bacteria triggers plant immune signalling networks downstream of PTI or ETI activation, with knock on effects on community structure. (Christine Vogel, 2016) determined that in response to some non pathogenic species, the detection of MAMPS leads to no change in gene expression. Note that some species of bacteria can induce transcriptional changes to protect the plants from infections of other species (Judith E. van de Mortel, 2012).  FHY3 FAR1  Plants have developed regulatory mechanisms in order to cope with adverse abiotic and biotic conditions (Bray EA, 2000), however these are a detriment to their growth and development. These regulatory mechanisms activate immune responses and resistance pathways in the case of biotic stress. Constitutive activation of plant immunity would lead to impaired growth and fitness, so in the absence of stress, the immune response must revert the massive transcriptional reprograming, requiring tight genetic control (Tian D, 2003).  Arabidopsis thaliana has to adapt to changes of environmental stimuli, such as light signals or temperature. Light duration, direction, wavelength, and quantity are determined by a battery photoreceptors which monitor incident red (R, 600-700 nm) and far red (FR, 700-750 nm) light wavelengths. This is achieved by switching between R absorbing and FR absorbing modes through biologically inactive Pr and active Pfr forms (PH, 2002). Photo activation of the primary photoreceptor for FR light phyA, causes translocation from the cytoplasm to the nucleus. This translocation allows induction of FR-responsive gene expression required for various photoreceptors. Two pairs of homologous genes are essential for the phyA signalling; FAR1 (far-red-impaired response 1) and FHY3 (far-red elongated hypocotyl 3). (Hudson, 2003) determined that these genes encode mutator like transposase derived transcription factors which directly bind to the promotor region HEMB1, which itself encodes a 5-1minolevuli   nic acid dehydratase, ALAD) and activates its expression, thereby regulating both chlorophyll biosynthesis and seedling growth (Tang W, 2012). These regulators small plant specific proteins, which are necessary for the nuclear accumulation of light activated phyA.  (Wanqing Wang, 2015) determined that fhy3 far1 double null mutants display an autoimmune response; accumulating SA and ROS, inducing PR genes and having an increased resistance to pathogen infection. They all displayed a dwarf phenotype, with necrotic lesions developing on their leaves as a result of premature cell death. Wang and his colleagues determined that FHY3 and FAR1 may act as defence-responsive gene repressors; mutants had high abundances of R genes and upregulated levels of PR genes, hinting at a possible link with regulation of NB-LRR mediated SA signalling pathways. Fhy3 far1 mutants increased expression levels of EDS1, PAD4, SID2 and EDS5  all genes involved in SA pathways. Reduction of HEMB1 in fhy3 far1 lead to a constitutively activated immune response, inducing system acquired resistance. (Wang Q, 2007) hypothesized that FHY3 and FAR1 may negatively regulate SA signalling and plant immunity through regulation of HEMB1 expression  providing a possible linkage between    light signalling and plant immunity.  Next Generation Sequencing  Most microbial communities present within nature are yet to be cultured within a laboratory; thereby leaving biomolecules such as nucleic acids, proteins, and lipids as our only source of information. For phylogenetic studies, surveys of the small ribosomal subunits (SSUs) for bacteria and the internal transcribed spacer (ITS) region of fungi are vital. Ribosomal genes are present in all organisms and contain regions which evolve slowly, coupled with faster evolving regions which permit fine tuning of taxonomic levels, to either family or genera. Note, that there also exists numerous databases for reference sequences and their respective taxonomies, such as SILVA (Pruesse, 2007) and the Ribosomal Database Project. This technique uses multiple primer pairs for each of the marker genes, each associated with its own taxon (William Walters, 2015). SSU rRNA genes are the standard reference sequence for taxonomic classification; calculating similarity between rRNAs. ITS regions are primari   ly sequenced for fungi due to the higher degree of variation they display as a result of low evolutionary pressure, and clear resolution below genus level (Bellemain, 2010). PCR amplification is performed, cloning and Illumina sequencing of the bacterial 16S rRNA and fungal 18S ITS performed and compared to databases hosted by NCBI to allow a benchmark for assessment of phylogeny (Cole JR, 2009).  Illumina sequencing was chosen due to the low cost and sequencing quality (Gregory B. Gloor, 2010). (Wang Q, 2007) determined that longer sequences are easier to assign to taxonomic groups, in this case, reads of 300bp were determined. Illumina sequencing has two main technologies: HISEQ, which generates more reads but requires a longer time, and MISEQ which provides less reads but at a longer sequence length, reduced time and reduced cost, hence its use in this experiment. The workflow of Illumina has four basic steps; a sequencing library is produced by random fragmentation of DNA/cDNA samples, followed by ligation of 5 and 3 adapters. These adapters are amplified through polymerase chain reaction (PCR) and the gel purified. Libraries are loaded onto flow cells, binding to a lawn of surface bound oligonucleotides which are complementary to the library adapters. Each of these fragments is amplified into distinct clonal clusters by the process of bridge amplification. Single bases ar   e then incorporated into DNA template strands. All the 4 reversible dNTPs are present during sequencing, natural competition reduces incorporation bias, thereby reducing error rates. Data analysis involves alignment of new identified sequence reads with a reference genome (Illumina, 2016).  Predictions  A previous understanding of the microbial communities to be expected on wild type Arabidopsis thaliana was vital in order to discern changes in community composition of fhy3 far1 double null mutant plants. Numerous studies have been performed to determine the microbiome of the rhizosphere and phyllosphere, mostly through the use of fingerprinting and clone libraries (Reisberg EE, 2012). Arabidopsis thaliana microbial communities have been studied at a genome wide level (Matthew W. Horton, 2014), due to potential ecological and agricultural interest  particularly when it comes to micro biotic resistance.  (Matthew W. Horton, 2014) determined that in wildtype Arabdopsis, the majority of OUTs are from families of Proteobacteria, Bacterioidetes and Actinobacteria. Common genera included Sphingomonas, Flavobacterium, Rhizobium and Pseudomonas. (J.M. Whipps, 2007) determined that the phylosphere was dominated by Alpharoteobacteria, Gammaproteobacteria and Bacteroidetes. Betaproteobacteria and firmicutes have also been noted to be present at high abundances. Acidobacteria, Actinobacteria and cyanobacteria have all been found in low abundances (J.M. Whipps, 2007).  Fungal OUTs tend to be from Ascomycete classes Dothideomycetes and Sordariomycetes and the basidiomycete class Tremellomycets (Matthew W. Horton, 2014). A study by (Delmotte N, 2009) analysed what bacterial communities are most abundant in naturally occurring A. thaliana phyllosphere and discovered Methylobacterium, Sphingomonas and Pseudomonas to be the most prevalent. Commensals belonging to the genus Sphingomonas have been linked with protecting plants from pathogens (Innerebner G, 2011). Many of the genera are pathogenic; such as Epicoccum, Alternaria, Mycospharella, Fusarium and Plectspharella..Interestingly, a lot of these genera are seed transmitted, suggesting a reason for their permanent association with A. thaliana.   Microbial communities are largely shaped around host genetics, with changes in genes relating to defence response yielding the greatest changes in microbial communities. Due to the fhy3 far1 double null mutants constitutively activated immune response, one can assume that the plant will have an enhanced resistance against pathogenic organisms.  Materials and Methods  Plant Material, Growth Conditions and Extraction of Phyllospheric Microbes  The fhy3 far1 double null mutant line of Arabidopsis thaliana with a Nossen (No-0) ecotype was obtained from the Xing Wang Deng group at Yale university, New Haven, USA (Wang and Deng, 2002). Double mutant plant lines fhy3-4 and far1-2 were produced through 1-Methylsulfonyloxyethane (EMS)-mutagenesis by Hudson et al (1999). Plants displayed a dwarfism phenotype, necrotic lesions on their leaves and accumulation of both ROS and SA.  Plants were grown in standard controlled environment chambers in white light at a Photon Flux Density of 164 à µmol m-2 s-1 in short day conditions which correspond to 8 hours of light and 16 hours of darkness for 4 weeks. Plants were grown on a compost mixture consisting of 6 parts Levington M3 (Scotts, UK), 6 parts John Innes number 3 (Westland, UK), and 1 part (Sinclair, UK).  Phyllospheric microbes were extracted according to the protocol from Zhou et al (1996). The above ground growing parts from at least six plants were pooled for each sample. 100 mg of above ground growing parts of WT and fhy3 far1 mutant plants, 2.7 ml of DNA extraction buffer and 10 à µl of proteinase K (10 mg/ml) were added in falcon tubes. Tubes were shaken horizontally at 225rpm at RT for 30 mins. 0.3 ml of 5% SDS was added and tubes were incubated at 65à °C for 2 h with gentle mixing. The samples were centrifuged at 6,00 g for 10 min at RT and supernatants were collected. Pellets were extracted two more times after addition of 0.8 ml of extraction buffer and 20 à µl of 5 % SDS. Tubes were vortexed for 10 sec, incubated at 65à °C for 10 min and centrifuged. Supernatants from all three cycles of extractions were combined and mixed with equal volumes of chloroform-isoamyl alcohol (24:1, vol/vol). The aqueous phase was recovered by centrifugation and precipitated with 0.6 volume    of isopropanol at RT for 1 h. The pellet of crude nucleic acids was obtained by centrifugation at 16,000g for 20 min at RT. The pellet was washed with ice cold 70 % ethanol, dried at 37à °C and resuspended in sterile deionized water for a final volume of 500 à µl.  DNA extraction buffer contained 100 mM Tris-HCl (pH 8.0), 100 mM sodium EDTA (pH 8.0), 100 mM sodium phosphate (pH 8.0), 1.5 M NaCl and 1% CTAB.  PCR for High-throughput Sequencing and Sequencing Analysis  PCRs for bacteria and fungi rDNA-related sequences were performed in volumes of 20 à µl, with 1 x GoTaq Flexi Buffer, 1.5 mM MgCl2, 200 à µM dNTPs, 0.2 à µM forward primer, 0.2 à µM reverse primer, 1.25 units of GoTaq Flexi DNA Polymerase, 1 à µl colony suspension and distilled water.  To amplify bacterial 16S rDNA and reduced mitochondria- and chloroplast-specific rDNA-amplicons, two PCRs were run. PCR primer pair 63f 63f (5-CAGGCCTAACACATGCAAGTC-3) / 1492r (5-GGCTACCTTGTTACGACTT-3) used for amplification of bacterial, mitochondria and chloroplast specific rDNA amplicons. The degenerative primer 783r (5-CTACCVGGGTATCTAATCCBG-3) is a mix of nine primers (783r-a1 (CTACCAGGGTATCTAATCCTG), 783r-b1 (CTACCGGGGTATCTAATCCCG), 783r-c1 (CTACCCGGGTATCTAATCCGG), and 783r-a2 (CTACCGGGGTATCTAATCCTG), 783r-b2 (CTACCCGGGTATCTAATCCCG), 783r-c2 (CTACCAGGGTATCTAATCCGG), and 783r-a3 (CTACCCGGGTATCTAATCCTG), 783r-b3 (CTACCAGGGTATCTAATCCCG), 783r-c3 (CTACCGGGGTATCTAATCCGG)). The degenerative primer 783r was designed to reduce amplification of chloroplast 16S rDNA (Sakai et al., 2004). For amplification of fungal intergenic spacers, the primer ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS2 (GCTGCGTTCTTCATCGATGC) (White et al., 1990) were used.  Eventually, 200 ng of DNA per sample, consisting of 100 ng DNA from bacteria-specific primer PCR and 100 ng DNA from fungi-specific primer PCR, were sent for high-throughput sequencing using the Illumina MiSeq platform to the Department of Epidemiology and Biostatistics, Institute for Computational Biology, Case Western Reserve University, Ohio, USA.  Data processing  Samples S13 and S15 consisted of sequences from the fhy3 far1 double null mutant whilst samples S14 and S16 belonged to the wild type Arabidopsis thaliana. A collective total of 182218 and 496243 sequences were present for fhy3 far1 and wildtype samples respectively. The first 20,000 sequences of each of the four samples were retrieved from the raw FASTQ data files using the cut feature of NextGen Sequence Workbench (Heracle BioSoft, 2016). FASTQC High Throughput Sequence QC Report v0.11.5 (Simon Andrews, 2011-15) was used to analyse sequence quality. FASTQ sequences were converted to FASTA format with FASTQ to FASTA converter from the Galaxy platform (Gordon, 2016). Sequences with a Phred quality score under 20 were trimmed using default parameters of Trim Galore! (Krueger, 2016). Paired end reads were trimmed to discard the leading 8bp barcode. VSearch was used for sample dereplication (Rognes Torbjà ¸rn, 2015). Due to the composite nature of the samples (containing both bacterial    and fungal reads), a method had to be devised to separate them.  SILVAngs was used to provide data analysis for 16S bacterial amplicon reads through an automatic software pipeline using the SILVA rDNA database (Quast C, 2013). SILVAngs was unable to process the 18S ITS fungal sequences. Through the SILVA output, recognised bacterial sequences were determined for each sample. Using NextGen Sequence Workbench (Heracle BioSoft, 2016), these recognised bacterial sequences could be marked as contaminants and removed from the raw FASTA sequence data files, thereby leaving the fungal reads. Basic Local Alignment Search Tool from NCBI were used on the FASTA sequences (Altschul, 1990). Parameters were altered so that only the ten most similar alignments were retrieved per sequence.  A pipeline was built using python and local copies of mapping files maintained by GenBank (Dennis A. Benson, 2005): ftp://ftp.ncbi.nih.gov/pub/taxonomy/gi_taxid_nucl.dmp.gz for corresponding taxonomic IDs for GIDs and ftp://ftp.ncbi.nih.gov/pub/taxonomy/taxdump.tar.gz for matching taxonomic ID to scientific names. The pipeline functioned by converting genbank IDs to taxonomic ID and abundance count. The taxanomic ID was then matched to scientific names and defined to a taxonomic hierarchy. Sequences with an abundance under 3 were removed as singletons. Sequences assigned to A. thaliana chloroplast 16S rRNA gene or mitochondria were removed.  Statistical analysis  For diversity computation, samples were rarefied to the sample with the lowest sampling effort (3390 for fungal and 4988 for bacterial). Diversity indices, richness estimators, rarefaction curves and eigenvector techniques such as principal component analysis were all performed using PAST 3.14 (Hammer, 2001). Wilcoxon Signed-Rank test was performed using IBM SPSS Statistics (IBM Corp, 2013). Heatmaps were generated using (Wahlestedt, 2016). Krona plug in was used for abundancy chats (Ondov BD, 2011)  Results  Statistical Analysis of Bacterial Communities  Statistical analysis at a genus level indicated the following. Rarefaction curves showed a lack of sampling depth in fhy3far1. Diversity t tests determined that fhy3 far1 mutants displayed a greater diversity in comparison to wildtype A. thaliana, with a Shannon index of 3.51 and 2.85 respectively. Dominance values indicate that wild type A. thaliana contained select few genera which dominated the sample size. Simpson_1-D indicated that fhy3 far1 mutants possessed the greatest amount of sample diversity, though only marginally (0.95 and 0.91 respectively), whilst Evenness was highest in wildtype. Shannon index determined that fhy3 far1 samples had greater alpha diversity, confirmed by a Chao-1 score of 222.7, indicating greater species richness. Beta diversity was also greater in fhy3 far1. Alpha diversity indices are all displayed in table 1.  Wilcoxon Signed-Rank test was performed with the null hypothesis that wild type and fhy3 far1 samples would contain similar bacterial community composition. The results indicate that the fhy3 far1 plant had 165 species with a higher abundance than in wild type A. thaliana. Test statistics indicated that fhy3 far1 contained a statistical difference in microbial abundances (P  Principal component analysis at a phylum level revealed that PC 1 (98.5%) and PC2 (1.46%) were able to explain 99% of the variation. The result indicated a higher association of Baceroidetes and Acidobacteriales with fhy3 far1, separating it from the wild type which had higher correlation with Actinobacteria and Firmicutes. At a genus level (figure 2), wild type A. thaliana is correlated with Bacillales, Bacillus, Brevibacterium, Sphingomonas, Rhizobiales and Lysobacter. Genera associated with fhy3 far1 were determined to be Devosia, Advenella, Chitinophaga, Shinella, Rhizobium, Pricia and Pedobacter.  Discussion  Despite Arabidopsis thaliana having been studied for over 20 years in respect to the mechanisms of its immune responses (Kunkel, 1996), its not until the works of (Joel M. Kniskern, 2007) and (Matthew W. Horton, 2014) that an insight into the natural bacterial and fungal communities of A. thaliana  was made. The aims of this project were to determine the commensal bacterial and fungal communities of A. thaliana and investigate the effect of the fhy3 far1 mutants constitutively activated immune response on said communities. In this study, we characterized the phyllosphere of wild type and fhy3 far1 mutant Arabidopsis thaliana using an Illumina sequencing survey of 16S rRNA and 18S ITS genes.  To explain the results observed, we had to examine the effects of a constitutively activated immune response. The fhy3 far1 double null mutant has no way of negatively regulating SA signalling, this is due to the fact that FHY3 and FAR1 negatively regulate both stress and defence responsive genes, some of which are involved in the SA signalling pathway (EDS1, SID2, PAD4 and NDR1) (Wanqing Wang, 2015). This also induced the expression of a large amount of CC-NB-LRR and TIR-NB-LRR type R proteins. Many of these R genes will encode for protein homologs which mediate resistance against specific genera of bacteria and fungi. Some gene products can contain pathogen growth by indirect means; reinforcing the defensive capabilities of host cell walls and inducing stomatal closure (Jorg Durner, 1997). Alternatively, R gene products which have direct effects are usually antimicrobial metabolites (phytoalexins), papillae formation and induction of JA signalling and HR. Due to ETI being a direct    tailored response to specific effectors detected by R proteins, it stands to reason that the activation of R genes will have a more profound effect on pathogenic species producing effectors. ETI commonly leads to an apoptic hypersensitive response, as observed by the necrotic lesions (Jorg Durner, 1997). As non-pathogenic species are unlikely to produce effectors (Toni J. Mohr, 2008), they wont receive an ETI response and therefore may be resistant to the immune response. Alternatively, non-pathogenic species may possess a suite of effector proteins which allow the nonpathogen to overcome some host defence systems (Grennan, 2006).The reactive oxygen species accumulation can be seen as the plants establishment of defence, strengthening host cell walls by cross linking glycoproteins, or act as executioners of pathogens by lipid peroxidation and membrane damage (Miguel Angel Torres, 2006). Alternatively, it may function as a plant signalling molecule, much in the likes of salicylic aci   d.  Constitutive immune activation reduces abundance of pathogenic bacteria, but not pathogenic fungi.  Interestingly, we discovered that fhy3 far1 A. thaliana plants showed a decreased abundance of bacterial species associated with pathogenesis, thereby indicating that the effector triggered immunity response was effective and targeted towards pathogens. We were not able to show a specificity in plant response to non-pathogenic bacteria, as these too were affected by the ETI, seemingly without discrimination. Numerous reports indicate that the effects of plant defence processes on the microbiome are variable, with SAR being responsible for controlling the populations of some bacteria. (John W. Hein 2008) determined significant differences in rhizopshere bacterial community composition in A. thaliana mutants deficient in systemic acquired resistance (SAR), however, direct chemical activation of SAR by (Peter A.H.M. Bakker, 2013) caused little difference in community composition. (Joel M. Kniskern, 2007) analysed the effects of salicylic acid mediated defense induction, simmilarly to wh   at we have tried to show in this experiment, conclusing a change in phyllospheric communities; notable a reduction in deiversity of endophytes, but higher epiphytic diversity, in concordance with our findings.  We also concluded that the mutants constitutively activated immune response had no real effect on pathogenic fungi, in fact- the mutant hosted an increased abundance of pathogenic fungi. This was unusual due to the assumption that ETI would be targeted towards these species. This hints at the possibility that fungal communities are shaped by the bacterial communities present on the plant. It has been noted that SA and SAR do not contribute to resistance to necrotrophic pathogens (Joanna Ãâ¦Ã azà ´niewska, 2010), however some literature contradicts our findings.  Bacterial community diversity is increased in fhy3 far1 A. thaliana   Our initial survey of the wild type bacterial communities of A. thaliana in samples 14 and samples 16 revealed a disparity in initial composition, however a Wilcoxon Signed Ranks test indicated no statistically significant difference between the two. 91 different morphotypes were detected and assigned to species on the basis of 16S sequence alignment.  The most abundant species, Bacillales and Bacillus from the order Bacillalesare unusual in that they have not been previously described in A. thaliana. These high abundances are only from Sample 14, and were not observed in Sample 16. This may be a sequencing error or alternatively due to contamination. Bacillus have been described as mutually beneficial rhizobacterium in some plants; providing plants with growth promoting traits (Nathaniel A. Lyngwi, 2016). The Gammaproteobacteria of the genera Pseudomonas were found in a high abundance, a result which coincides with the literature (Matthew W. Horton, 2014) (J.M. Whipps, 2007). (Fumiaki Katagiri, 2002) has noted that Pseudomonas syringae is pathogenic to A. thaliana, triggering a hypersensitive response (HR)  a rapid associated death of plant cells. The fhy3 far1 mutant showed a severe decrease in abundance; which could be associated to the over expression of Arabidopsis R genes: RPS2, RPM1, RPS4, RPS5 and PBS1, which mostly belong    to nucleotide binding site-leucine rich repeat classes of R genes (Fumiaki Katagiri, 2002). (Wanqin    
Friday, January 17, 2020
Analysis of Myth of Total Cinema: Bazin
The Myth of Total Cinema Andre Bazin in his article, The Myth of Total Cinema, asserts that motivation behind cinema is realism. He explains his theory by examining the technology of cinema. He argues that cinema was not born from the technology advancement but rather from innate desire to reproduce the realism of our world. ââ¬Å"The basic technical discoveries [are] fortunate accidentsâ⬠¦ essentially second in importance to the preconceived ideas of the inventorsâ⬠ (Bazin, 200). What Bazin means is that the invention of technology was not to gain profit rather to replicate and reproduce our real world on screen.Though he does argue that some were in it for the profit of the technology. Inventors of photography and cinema thought about what they will show and reproduce primarily to how they will achieve the reality of the world. In another words, the essential drive to reproduce the real led to the production of technology. The desire for realism did not come from the prod   uction of technology. Bazin goes on to explain that our understanding of cinema should not derive from the technology but from the reality that is perceived through the reproduction.  Related article: Odeon Cinema PestleBazin goes on to state that: ââ¬Å"The guiding myth, then, inspiring the invention of cinema, is the accomplishment of that which dominated in a more or less vague fashion all the techniques of the mechanical reproduction of reality in the nineteenth century, from photography to phonograph, namely an integral realism, a recreation of the world in its own image, an image unburdened by the freedom of interpretation of the artist or the irreversibility of timeâ⬠ (Bazin, 202). What he is trying to elucidate is that the guiding myth of realism and cinema should be the production of cinema unburdened by an artistââ¬â¢s interpretation or subjectivity.It also means that the time is not restricted. In addition Bazin continues, ââ¬Å"The real primitives of the cinema, existing only in the imaginations of a few men of the nineteenth century, are in complete imitation of natureâ⬠ (Bazin, 202). He is stating that a real cinema is established by t   hose who dream of cinema as a replicate of nature. Bazin concludes that the myth of total cinema is ââ¬Ërealismââ¬â¢, and that it has been a part of every man before invention of technology. Bazinââ¬â¢s article is very interesting and reasonable but his arguments only justify one side of the story.Cinema is not only a tool for reproduction of nature but also an apparatus for fantasy and dreams. It can be argued, I too agree, that the development of technology was created for the purpose of recreating nature, but the development of technology has advanced artistically. This artistic development of technology has aided many in creating their imagination that are beyond reality. For example, the film, Inception, contains scenes that are impossible to film in reality. Scenes containing upside buildings, never ending stairs, buildings crumbling and etc. are very difficult to accomplish without the help of the advancing technology. Yet the advancing technology has made it possibl   e to create the impossible. What I am trying to say is that the story of Inception was not created prior to the advancement of technology but after. The story of the film was thought out with the possibilities of the technology in mind. Bazin maybe correct in stating that cinema was essentially the instinctive drive of human desire to reconstruct and imitate reality though we can argue that it is not the ââ¬Ëonlyââ¬â¢ drive of cinema.    
Thursday, January 9, 2020
Testing and Applications of Composite Materials - Free Essay Example
  Sample details    			        Pages: 4 Words: 1293 Downloads: 5 Date added: 2019/03/18                         	                                                                                Category                                      							        Analytics Essay                                                              	                      	                      	                                                                              Level                                      							        High school                                                            	                                            			                                                              Tags:                              					                Characterization Essay                            			                                                                                                                                                                                                                                                                Did you like this example?                                                                                                                                                    Youngs modulus is an important giveaway of the materials capabilities to withstand changes in the length of its specimen when a stress is applied along its length, whether it is compression or elongation. This valuable information is crucial in making decisions about which composite material is suitable for what application. Therefore, the combination of DIC and FEA methods analysis is a great approach if one wants to obtain a stress-strain curves that include fracture strain in a composite material, which makes the determination of Youngs modulus very easy.[4]  Tensile testing proves to be one of the most successful traditional methods of testing for composites strength and its corresponding characteristics. However, not every composite material can be tested equally and under the same experiment setup. Namely, the type of reinforcement of a composite material plays a great role in this determination. If one recalls that there are continuous and discontinuous fibers used for reinforcement, it is important to remember that when the continuous fibers are used, the material obtains unidirectional properties, meaning that the properties of the material are specifically oriented to one location. Different properties are obtained after applying loads in different directions; along, across and normal to the direction of the fibers. Because of these characteristics, unidirectional composites are challenging to test under tensile testing. Namely, the traditional clamps for tensile testing used to hold the specimen in place may induce unwanted stress   es at the clamped specimen areas, which will disrupt the experiment results and accuracy of the further results analysis. This paper proposes several ideas on how to improve the existing setup for tensile stress testing. One recommendation is to use a thin specimen for testing in order to reduce the stress concentration across the depth of the specimen, reducing numerically any unwanted induced stresses. However, it is important for the specimen to still retain the original material properties, meaning that one needs to carefully choose the minimum depth that one wishes to test. This approach requires more details and information about the tested composite, specifically the minimum thickness of the specimen that can successfully represent the materials properties. Another recommendation is to use longer clamps in order to have uniform stress distribution over a bigger part of the specimen area, meaning that the stress concentration will not be contained only in a small outside area    of the specimen. This approach is somewhat limiting as it will leave a very small specimen area that can be actually tested. Lastly, this paper indicates that American Society for Testing and Materials (ASTM) has suggested a different approach as a solution to this issue. ASTM suggestion is that if the clamps used for tensile testing are made of the same material as the composite, the induced stresses will be minimized. This approach has proven to be successful in several experiments, but it can be limiting to experiments where the specimen composite is relatively weak and not well bonded or reinforced. For most common applications, such as high-performance applications, this would not be the case, so the approach will be valid. [5]  	Donââ¬â¢t waste time! Our writers will create an original "Testing and Applications of Composite Materials" essay for you  	Create order      After reviewing several existing testing methods, this paper suggested a new method for testing the composite materials for their strength characteristics. Namely, this experiment will test the composite under fatigue and static loadings. The main concept behind this experiment is to keep the end-to-shear load ratio constant along with the load translation. This is possible by using a specific mechanism that is able of controlling a gripping pressure of the loaded specimen. The main idea behind this experiment setup was a great success of a similar experiment used for static loading; now, a similar but significantly updated setup will be used for fatigue load testing. The clamps and several other fixtures that are used to secure the specimen in place were updated and advanced so that the experiment results are not influenced by a specimen slipping from the frame or by having clamps slide over the specimen surface. This modification from previous tests allows for accurate results of t   he fatigue strength. By keeping the end-to-shear ratio constant, the test can be repeated for several trials (or cycles) in order to yield different fatigue strengths that will help in creating a strength model specific for the composite material in question. Fatigue strength, also known as endurance limit, is a value of the stress that a material specimen can endure for several trials (or cycles) without breaking apart. By performing a specified number cycles of testing with different strength values, one can expect to have the specimen fall apart, as the strength and hardness of the composite material will decrease with the increase of cycles. Obtaining the highest possible stress values that a material can withstand for a specific amount of time is a very valuable and important piece of information to know when making decisions about which composite material to attribute to a given application. If the application for which the material is intended requires a strong material that    can withstand many stresses applied over time (for example, bolts of the lawn mower must have high endurance because of the constant vibrations coming from the mower), choosing a strong material is crucial. However, applications that do not require extremely strong materials used can be performed with a lower-cost composites that will satisfy the required performance and be cost-effective at the same time. The above described method is, therefore, very useful in the analysis and categorization of the composite materials for various applications. Such experimental setup yields accurate fatigue strength results, which greatly help in making cost-effective decisions. [6]  Several testing methods for composites have been explored and presented, but if one thinks in terms of applying them to every kind of composite available, a question arises: all of these methods mainly rely on applying force to the specimen, so how can a brittle composite specimen be properly tested? Many of the current methods do not allow or may not be suitable for low force applications and testing, so some new methods must have been introduced. One of them is a Modified Short Beam Shear specimen, also known as MSBS. This specimen is used to suitably test brittle specimens for their interfacial or attachment strength. This specimen is made as a sandwich of two reasonably thick aluminum plates and the brittle composite that is supposed to be tested is laying between them. This setup allows for safe and accurate measurement of the strength of the composite material in question. One of the most brittle composites are made of thermosetting vinylester resin that is reinforced with carb   on tubes (multi-walled), also known as MWCNT. This sandwiched configuration allows for this brittle composite to be properly tested and explored for its strength characteristics. However, this setup does not produce a pure shear stress state in the composite, but the result is still applicable since the characteristics of this type of composite can be altered with chemical additions and changes. The whole experimental setup post-analysis is performed by using a finite element analysis method. This allows for the experimental results to create a suitable model that can be applied throughout different scenarios where this composite is being used. The failure mode is also a combination of normal and shear stresses, which is a typical testing result for very brittle composites like this one. Overall, this setup provides for a safe and experimentally successful environment in order to test composite materials for their strength properties even if they are categorized as highly brittle co   mposite materials. Although this test specifically refers to thermosetting vinylester resin that is being reinforced with multi-walled carbon nanotubes (MWCNT), considering the success of this experimental method, it is worth exploring if it will be applicable to other composite materials of the same or even higher level of brittleness.[7]    
Wednesday, January 1, 2020
Abstinence Only Education Is The Most Prevalent Form Of...
  Abstinence only education has been the most prevalent form of instruction in middle and high school courses for years in the United States. Instead of providing accurate scientific facts, it has been primarily based on ideology and what has been traditionally morally accepted: sexual activity within a heterosexual marriage. As a result, teenagers have been taught through biased information influenced by current heteronormative standards. Consequently, abstinence only education fails to acknowledge the minority populations of teenaged students who are different genders and sexualities other than a heterosexual male. Realistically, it can be inferred that a majority of the student bodies in America are rich in diversity. The classroom is no longer composed of homogenous individuals. Instead, classrooms are full of adolescents of various genders, sexualities, ages, and ethnicities. Abstinence only education strictly instructs through biological and reproductively compatible terms rather    than addressing other methods of having sex, specifically pertaining to the LGBTQ community. The current curricula typically teaches that penile-vaginal sex is the ââ¬Å"properâ⬠ way to have intercourse and that it is customary that sex occurs only between a man and a woman. Thus, emphasizing how genitalia should be used rather than having a more holistic approach towards sex. Ultimately, this disregards all of the possible mechanisms that exist when it comes to physical touch. As a consequence,Show MoreRelatedShould Sex Education Be Incorporated Into Public Schools?1372 Words à  |à  6 PagesFor Sex Education in Public Schools  An observation of the prevalent television programs and popular topics broadcasted in the media often depict teenagers with an air of promiscuity. Is teenage pregnancy really an uncontrolled epidemic, as depicted in shows such as ââ¬Å"16 and Pregnantâ⬠? Are a vast majority of teenagers exchanging racy photos of their bodies with each other? If so, are teenagers acting out because of too much sex education? Or is the outbreak of hyper-sexualized activity linked to lackRead MoreThe Controversial Issue Of Sex Education965 Words à  |à  4 PagesIn the early 1960ââ¬â¢s the controversial issue of sex education started to become a more prevalent conversation among educators and parents alike when the Food and Drug Administration approved the sale of oral contraceptives(Szustek, 2009). Though the topic was previously being discussed as early as mid to late 19th century, it was not deemed completely necessary or an appropriate topic for school aged children prior to this point. In t   he United States more than 750,000 girls between the ages of 15-19Read More Sex Education in School Essay1706 Words à  |à  7 Pagescases grade schools.  As the saying goes monkey see monkey do one can only assume that this concept will pertain to these easily influenced children. That is why it is imperative that another side of this issue is presented on a regular basis, a side that demonstrates safe sex as well as no sex. Sex is a basic instinct in all-living beings; sex education in Georgia public schools should encourage abstinence because it is the only sure way to prevent pregnancy and disease, but not dismiss protectiveRead MoreFree And Accessible Birth Control1722 Words à  |à  7 PagesFree and Accessible Birth Control in the United States    	A total of 730,322 abortions were reported from the Centers for Disease Control in 2011.  This could easily be resolved with proper usage of birth control.  But the fact of the matter is that only 62% of women are actually using proper birth control, now this may seem like a lot of women, but there is 158.6 million women in the United States alone so 58.5 million are currently not on any birth control which is a huge amount of women. Birth controlRead MoreThe Latino And Latino Culture Health Care1397 Words à  |à  6 Pagesteen age pregnancy are significantly more prevalent in Hispanic/Latino population as well. Rate of vaccination is also below that of the majority of the population. Addressing their health care makes good public health and economic sense.  Reasons for this discrepancies are many and varied, so different and varied approaches will be needed.      In the Hispanic/Latino culture health care is most commonly sought after when symptoms appear, and in may cases only when those symptoms cause the individualââ¬â¢sRead MoreEssay about  Sex Education in School4599 Words à  |à  19 PagesSex Education in School      Just say no, or say nothing at all.  Either live by the word of the Christian God, or live with disease and unsupportable families.  In current abstinence-only sexual education, this is the choice the nation gives to young people about their private sexuality.  Clear concise facts have given way to horrifying lectures of the fictional evils of sexual behavior that falls outside the lines drawn by the right wing and the Pope.  These tactics do not educate and only damageRead MoreA Constitutional Amendment: the Only Way to Protect Parental Rights to Direct the Upbringing and Education of Their Children3083 Words à  |à  13 PagesA Constitutional Amendment:  The Only Way to Protect Parental Rights to Direct the Upbringing and Education of Their Children              English 1020  May 1, 2008        Outline  Thesis:  In order to ensure that parental rights concerning the upbringing and education of their children remain fundamental rights in America, there must be an amendment to the United States Constitution explicitly stating parental rights.  I.	Parental rights are not specifically protected under the United States ConstitutionRead More The Impact of Lowering the Drinking Age on State University Essay4145 Words à  |à  17 Pages        The legal drinking age in the United States will always be a point of contention. No one can settle upon a drinking age that everyone is in agreement with; should it be 18 or 21? Ages 18 and 21 are the most popular options, yet neither one has 100% of the vote. With the current legal drinking age in America standing at 21, meaning that people under the age of 21 cannot purchase or consume alcoholic food or beverages, there is the question of whether or not to lower it to 18 or 19 years oldRead MoreHiv/Aids Summary of Research Study8804 Words à  |à  36 Pagestime of case reporting. Sexual contact was the most common mode of HIV transmission, accounting for 93% (799) of all reported AIDS cases. The number of HIV cases continues its upward trend, with the latest figure in January 2011, there    were 152 new HIV Ab sero-positive individuals confirmed by the STD/AIDS Cooperative Central Laboratory (SACCL) and reported to the HIV and AIDS Registry. This was a 6% increase compared to the same period last year. Most of the cases (93%) were males.        In the PhilippinesRead More Drug Abuse Among American Teenagers Essay7972 Words à  |à  32 Pagesthat teenagers use range from Alcohol, LSD, Marijuana, and even Cigarettes. Most of the teenagers that are involved in drug abuse have either, broken families, parents that are drug abusers, a unstable environment where they are constantly moving from place to place, or there parents arent exactly making a lot of money and they are never around because they are trying to make enough money for them to survive. But even to most ordinary teenager can have a drug problem depending on there friends, and    
Subscribe to:
Comments (Atom)
 
